people
3d Meeting
NITROGEN
Much of the nitrogen on earth is found in rocks (contrary to the intuitive guess) and not in the atmosphere, primarily in basal granite rocks. Minerals that develop from these rocks include ammonium, known as "fixed ammonium" or "crystallized ammonium". In sandy soils, with little clay content or in shallow soils - the content of fixed ammonium is of course smaller.
In nature nitrogen is found with all possible degrees of oxidation as follows (the degree of oxidation appears in brackets):
Preface
Preface
Prof. Uzi Kafkafi of the Field Crops Department in the Agriculture Faculty of the Hebrew University has the professional background and the ability to integrate ground theory and ground chemistry (in which he was involved for many years in the Faculty and in the Vulcani Centre) with plant biology and their environment.
We hope that this book will assist readers towards a better understanding, correct planning and successful implementation of the fertilization of agricultural crops, and this will be our reward.
Prof. Joseph Riov
Curriculum Vitae
Born 1939, Israel
Ph.D. 1970, Hebrew Universiy
Assoc. Prof. 1983
Prof. 1989
Emeritus 2008
Research Interests
Mechanisms of controlling adventitious root formation, with an emphasis on auxin activity and metabolism. Genetics of forest trees. Abscission control of plant organs.
Research Projects
1. Improving the rooting methods of cuttings of forest and fruit trees.
Selected Publications
Shohat H., Cheriker H., Cohen A. and Weiss D. (2022). Tomato ABA-IMPORTING TRANSPORTER 1.1 inhibits seed germination under high salinity conditions. Plant Physiol. https://doi.org/10.1093/plphys/kiac545
Teaching
Undergraduate courses
- Plant Physiology - 71015
- Physiology and Molecular Regulation of Flowering - 71449
Graduate courses
- Signal transduction in plants - 71101
Biography
Born in Basra, Iraq, 1939. Immigrated to Israel in 1951.
Joined the faculty of agriculture, Hebrew University of Jerusalem in 1973 as a Lecturer in biometrical genetics and breeding; promoted to the positions of senior lecturer, associate professor and full professor in 1978, 1989 and 1992 respectively.
During the years 1978-9, 1985-6, 1992, 1993, 1999 and 2001 spent sabbatical leaves at:
1) ABRO, Edinburgh, Scotland;
2) Leicester, England;
3) Guelph,Canada;
4) VPI, Virginia; and
5-6) Stanford University, USA.
Medical Cannabis
Genomic Improvement of Medical Cannabis
The target of medical cannabis improvement is to have specialized cannabinoids’ varieties from which the pharmaceutical industry can generate medicines for various diseases and medical health problems. It is essential to improve the current varieties of medical cannabis due to several inherent difficulties:
Samaritans
Genetic History Of The Samaritans
Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim
Human Biology, Volume 85, Number 6, December 2013, pp. 825-857 (Article)
Ethnic Groups
Genetic Identity Of Ethnic Groups In Israeli
Biodiversity and phylogenetic analysis
Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.
Diabetes Type 2
MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)
We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.