people

Ethnic Groups

Genetic Identity Of Ethnic Groups In Israeli

Biodiversity and phylogenetic analysis

Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.

 

Diabetes Type 2

MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.

Prof. Dani Zamir

Research 

Plant breeders are challenged with sustaining global crop improvements. Is there a limit to crop yield?

Our lab is addressing this question using three favorite plants: tomatoes, Lisianthus and autotetraploid roses.  By integrating in a single web-based platform a broad germplasm base, deep ontology defined phenotypes, and multiple genome sequences we identify genes and mechanisms that dictate crop productivity.

List of Publications

Wigoda N., Ben-Nissan G., Granot D., Schwartz A. and Weiss D. (2006) 
The gibberellin-induced, cysteine-rich protein GIP2 from Petunia hybrida exhibits in-planta antioxidant activity.
Plant J. 48: 796-805.

Maseyk KS., Lin T., Rotenberg E., Grünzweig JM., Schwartz A., Yakir D (2008) 
Physiology-phenology interactions in a productive semi-arid pine forest 
New Phytologist 178: 603-616

Students

The students who conducted the experiments deserve all the credit:

Post Doc.:   Dr. Yishai Netzer    Or Shapira 

Ph.D.:   Ron Seligmann    Ran Arael    Or Sperling 

M.Sc.:   Idan Baht    Sarel Munitz    Dror Dotan    Yotam Zit    Yechiam Gets    Amit Haklai    David Yelin

 

Table and wine grapes: Dr. Yishai Netzer Post Doc., Idan Baht, Sarel Munitz and Dror Dotan M.Sc. students. 

Prof. Amnon Schwartz

 

Research Interests:

Plant water relations, Calcium transport and distribution in the whole plant, Photosynthesis and stomatal conductance, Irrigation scheduling based on physiological parameters.

List of Publications

List of Publications (Hebrew publications and abstracts are not included)

Rubin, B. and Y. Eshel (1971). Phytotoxicity of fluometuron and its derivatives to cotton and weeds. Weed Science 19:294-295.

Eshel, Y. and B. Rubin (1972). Metabolism of fluometuron in cotton and weeds as a basis for selective action. In: Pesticide Chemistry: Herbicides, Fungicides, Formulation Chemistry. (A. S. Tahory, ed.)  5:113-124. Gordon and Breach, Science Publication.

Awards

1972 Grant and Award from the "Histadrut" for Outstanding Young Scientists.
1976 Grant and Award from "Mifal-Hapays" for Outstanding Young Scientists.
1981-1982 Awards and Research Grant from E. D. Bergman Fund.
1981 Grant and Award from D. Ben-Gurion Fund.
2001

Patents

Margulies, L; Y. El-Nahhal; B. Rubin; S. Nir. (1996). Slow release formulations of pesticides: Israel Patent No. 119142; Europe - WO 98 08380; US Patent No. 6,261,997 B1.

S. Nir; B. Rubin; Y. Mishael; T. Undabeytia; O. Rabinovitz; T. Polubesova (2006). Controlled release formulations of anionic herbicides. US patent no. US-7,030,062; EP patent 1363491, AU patent 2002219479.

Curriculum Vitae

Emeritus Professor of Agronomy and Weed Science. R. H. Smith Institute of Plant Science and Genetics in Agriculture, R. H. Smith Faculty of Agriculture, Food and Environment, Hebrew University of Jerusalem, Israel.

Projects

Herbicide resistance in weeds and in transgenic crops: