check
people | Plant Sciences and Genetics in Agriculture

Contact Us

 

Mailing Address:
The Robert H. Smith Institute of
Plant Sciences and Genetics
in Agriculture
Herzl 229, Rehovot 7610001, Israel

Administrator: 
Neomi Maimon 
Tel: 972-8-948-9251,
Fax: 972-8-948-9899,
E-mail: neomim@savion.huji.ac.il

Secretary of teaching program:
Ms. Iris Izenshtadt
Tel: 972-8-9489333
E-mail: Iris.Izenshtadt@mail.huji.ac.il

Director: 
Prof. Naomi Ori
Tel: 972-8-948-9605
E-mail: naomi.ori@mail.huji.ac.il

 

people

3d Meeting

NITROGEN

Much of the nitrogen on earth is found in rocks (contrary to the intuitive guess) and not in the atmosphere, primarily in basal granite rocks. Minerals that develop from these rocks include ammonium, known as "fixed ammonium" or "crystallized ammonium". In sandy soils, with little clay  content or in shallow soils - the content of fixed ammonium is of course smaller.

In nature nitrogen is found with all possible degrees of oxidation as follows (the degree of oxidation appears in brackets):

Preface

Preface

Prof. Uzi Kafkafi of the Field Crops Department in the Agriculture Faculty of the Hebrew University has the professional background and the ability to integrate ground theory and ground chemistry (in which he was involved for many years in the Faculty and in the Vulcani Centre) with plant biology and their environment. 

We hope that this book will assist readers towards a better understanding, correct planning and successful implementation of the fertilization of agricultural crops, and this will be our reward. 

Prof. Joseph Riov

Curriculum Vitae

Born 1939, Israel

Ph.D. 1970, Hebrew Universiy

Assoc. Prof. 1983

Prof. 1989

 Emeritus 2008

Research Interests

Mechanisms of controlling adventitious root formation, with an emphasis on auxin activity and metabolism. Genetics of forest trees. Abscission control of plant organs.

Research Projects

1. Improving the rooting methods of cuttings of forest and fruit trees.

Teaching

Undergraduate courses

  • Plant Physiology - 71015
  • Physiology and Molecular Regulation of Flowering - 71449

Graduate courses

  • Signal transduction in plants - 71101

Biography

Born in Basra, Iraq, 1939. Immigrated to Israel in 1951.

Joined the faculty of agriculture, Hebrew University of Jerusalem in 1973 as a Lecturer in biometrical genetics and breeding; promoted to the positions of senior lecturer, associate professor and full professor in 1978, 1989 and 1992 respectively.

During the years 1978-9, 1985-6, 1992, 1993, 1999 and 2001 spent sabbatical leaves at: 
 
1) ABRO, Edinburgh, Scotland; 
2) Leicester, England; 
3) Guelph,Canada; 
4) VPI, Virginia; and 
5-6) Stanford University, USA.

Medical Cannabis

Genomic Improvement of Medical Cannabis

The target of medical cannabis improvement is to have specialized cannabinoids’ varieties from which the pharmaceutical industry can generate medicines for various diseases and medical health problems. It is essential to improve the current varieties of medical cannabis due to several inherent difficulties:

Samaritans

Genetic History Of The Samaritans

Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim

Human Biology, Volume 85, Number 6, December 2013, pp. 825-857 (Article)

Ethnic Groups

Genetic Identity Of Ethnic Groups In Israeli

Biodiversity and phylogenetic analysis

Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.

 

Diabetes Type 2

MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.