people

Cotton2K Model

Cotton2K Model version 4.0

A. Marani

Version history

The COTTON2K cotton simulation model is descended from GOSSYM-COMAX. Its main purpose was to make the model more useful for conditions of cotton production under irrigation in the arid regions of the Western USA. Since many changes have been made in the model, it has been given a new name: CALGOS (for CALifornia GOSsym). The present version, which is completely revised has been renamed COTTON2K.

Cotton2K Version 4.0

Cotton2K Model Version 4.0

Cotton2K is a cotton simulation model specially adapted for irrigated cotton production in arid regions. It was written by:

Avishalom Marani
Professor Emeritus at the Institute of Plant Science
School of Agriculture of the Hebrew University of Jerusalem
P.O.Box 12, Rehovoth 76100, Israel

Research Abstracts

Abstracts of Publications (2005-2014)

Brown JK, Lambert GM, Ghanim M, Czosnek H and Galbraith DW (2005).
Nuclear DNA Content of the Whitefly Bemisia tabaci (Genn.) (Aleyrodidae: Homoptera/ Hemiptera) Estimated by Flow Cytometry. Bulletin of Entomological Research. 95:309-312.

Supplementary Data

Download original word file

Supplementary Data Table

Means of water loss rate (WLR), relative water loss (RWL), fruit fresh weight (FFW), pericarp surface area (PSA), pericarp weight per surface (PWS) and relative dry matter content (RDM) of 161 genotypes analyzed, grown for 2 years (2001-02 and 2002-03) in the Arava Valley of southern Israel.

Prof. Joseph Riov

Curriculum Vitae

Born 1939, Israel

Ph.D. 1970, Hebrew Universiy

Assoc. Prof. 1983

Prof. 1989

 Emeritus 2008

Research Interests

Mechanisms of controlling adventitious root formation, with an emphasis on auxin activity and metabolism. Genetics of forest trees. Abscission control of plant organs.

Research Projects

1. Improving the rooting methods of cuttings of forest and fruit trees.

Teaching

Undergraduate courses

  • Plant Physiology - 71015
  • Physiology and Molecular Regulation of Flowering - 71449

Graduate courses

  • Signal transduction in plants - 71101

Biography

Born in Basra, Iraq, 1939. Immigrated to Israel in 1951.

Joined the faculty of agriculture, Hebrew University of Jerusalem in 1973 as a Lecturer in biometrical genetics and breeding; promoted to the positions of senior lecturer, associate professor and full professor in 1978, 1989 and 1992 respectively.

During the years 1978-9, 1985-6, 1992, 1993, 1999 and 2001 spent sabbatical leaves at: 
 
1) ABRO, Edinburgh, Scotland; 
2) Leicester, England; 
3) Guelph,Canada; 
4) VPI, Virginia; and 
5-6) Stanford University, USA.

Medical Cannabis

Genomic Improvement of Medical Cannabis

The target of medical cannabis improvement is to have specialized cannabinoids’ varieties from which the pharmaceutical industry can generate medicines for various diseases and medical health problems. It is essential to improve the current varieties of medical cannabis due to several inherent difficulties:

Samaritans

Genetic History Of The Samaritans

Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim

Human Biology, Volume 85, Number 6, December 2013, pp. 825-857 (Article)

Ethnic Groups

Genetic Identity Of Ethnic Groups In Israeli

Biodiversity and phylogenetic analysis

Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.

 

Diabetes Type 2

MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.