Cotton2K Model Open Source Code

• Introduction
• Copyright information
• List of files and functions
• Downloading information

Cotton2K Model version 4.0

A. Marani

The COTTON2K cotton simulation model is descended from GOSSYM-COMAX. Its main purpose was to make the model more useful for conditions of cotton production under irrigation in the arid regions of the Western USA. Since many changes have been made in the model, it has been given a new name: CALGOS (for CALifornia GOSsym). The present version, which is completely revised has been renamed COTTON2K.

Cotton2K Model Version 4.0

Cotton2K is a cotton simulation model specially adapted for irrigated cotton production in arid regions. It was written by:

Avishalom Marani
Professor Emeritus at the Institute of Plant Science
School of Agriculture of the Hebrew University of Jerusalem
P.O.Box 12, Rehovoth 76100, Israel

Abstracts of Publications (2005-2014)

Supplementary Data Table

Means of water loss rate (WLR), relative water loss (RWL), fruit fresh weight (FFW), pericarp surface area (PSA), pericarp weight per surface (PWS) and relative dry matter content (RDM) of 161 genotypes analyzed, grown for 2 years (2001-02 and 2002-03) in the Arava Valley of southern Israel.

Curriculum Vitae

Born 1939, Israel

Ph.D. 1970, Hebrew Universiy

Assoc. Prof. 1983

Prof. 1989

 Emeritus 2008

Research Interests

Mechanisms of controlling adventitious root formation, with an emphasis on auxin activity and metabolism. Genetics of forest trees. Abscission control of plant organs.

Research Projects

1. Improving the rooting methods of cuttings of forest and fruit trees.

Born in Basra, Iraq, 1939. Immigrated to Israel in 1951.

Joined the faculty of agriculture, Hebrew University of Jerusalem in 1973 as a Lecturer in biometrical genetics and breeding; promoted to the positions of senior lecturer, associate professor and full professor in 1978, 1989 and 1992 respectively.

During the years 1978-9, 1985-6, 1992, 1993, 1999 and 2001 spent sabbatical leaves at: 
 
1) ABRO, Edinburgh, Scotland; 
2) Leicester, England; 
3) Guelph,Canada; 
4) VPI, Virginia; and 
5-6) Stanford University, USA.

Genetic History Of The Samaritans

Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim

Human Biology, Volume 85, Number 6, December 2013, pp. 825-857 (Article)

Genetic Identity Of Ethnic Groups In Israeli

Biodiversity and phylogenetic analysis

Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.

MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.