Born in Basra, Iraq, 1939. Immigrated to Israel in 1951.

Joined the faculty of agriculture, Hebrew University of Jerusalem in 1973 as a Lecturer in biometrical genetics and breeding; promoted to the positions of senior lecturer, associate professor and full professor in 1978, 1989 and 1992 respectively.

During the years 1978-9, 1985-6, 1992, 1993, 1999 and 2001 spent sabbatical leaves at: 
 
1) ABRO, Edinburgh, Scotland; 
2) Leicester, England; 
3) Guelph,Canada; 
4) VPI, Virginia; and 
5-6) Stanford University, USA.

Genetic History Of The Samaritans

Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim

Human Biology, Volume 85, Number 6, December 2013, pp. 825-857 (Article)

Genetic Identity Of Ethnic Groups In Israeli

Biodiversity and phylogenetic analysis

Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.

MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.

In a project on biodiversity of chickens funded by the European Commission (EC), eight laboratories collaborated to assess the genetic variation within and between 52 populations from a wide range of chicken types.

הגיגים על ישראל ופלסטין

Selected articles, out of more than 180 publications

• Z. Granevitze, L. David, T. Twito, S. Weigend, M.Feldman, and J. Hillel, 2013, Phylogenetic resolution power of microsatellites and various SNP types assessed in ten divergent chicken populations. Animal Genetics 2014: 87-95.

Professor emeritus of the Hebrew University of Jerusalem, Israel.

Population and Quantitative geneticist with experience in gene mapping projects. These projects were aimed to detect genes (QTLs) controlling quantitative complex traits.

In recent years, efforts were made to use Deep Sequencing technologies for QTLs detection and biodiversity studies. The detected QTLs were used to produce customized microarrays as tools in breeding programs based on Genomic Selection.