MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.

The Experimental Animal Population

We investigated the mode of inheritance of nutritionally induced diabetes in the desert gerbil Psammomys obesus (sand rat), following transfer from low-energy (LE) to high-energy (HE) diet which induces hyperglycaemia. Psammomys selected for high or low blood glucose level were used as two parental lines. A first backcross generation (BC1) was formed by crossing F1 males with females of the diabetes-prone line. The resulting 232 BC1progeny were assessed for blood glucose. All progeny were weaned at 3 weeks of age (week 0), and their weekly assessment of blood glucose levels proceeded until week 9 after weaning, with all progeny maintained on HE diet. At weeks 1 to 9 post weaning, a clear bimodal distribution statistically different from unimodal distribution of blood glucose was observed, normoglycaemic and hyperglycaemic at a 1:1 ratio. This ratio is expected at the first backcross generation for traits controlled by a single dominant gene. From week 0 (prior to the transfer to HE diet) till week 8, the hyperglycaemic individuals were significantly heavier (4–17%) than the normoglycaemic ones. The bimodal blood glucose distribution in BC1generation, with about equal frequencies in each mode, strongly suggests that a single major gene affects the transition from normo- to hyperglycaemia. The wide range of blood glucose values among the hyperglycaemic individuals (180 to 500 mg/dl) indicates that several genes and environmental factors influence the extent of hyperglycaemia. The diabetes-resistant allele appears to be dominant; the estimate for dominance ratio is 0.97.

Jossi_Hillel

Tino Strauss [CC BY-SA 2.5], via Wikimedia Commons

Type 2 Diabetes Melitus

T2DM is a long term metabolic disorder that is characterized by high blood sugar, insulin resistance, and relative lack or low insulin production. Common symptoms include increased thirst, frequent urination, and unexplained weight loss. Long-term complications from high blood sugar include heart disease, strokes, diabetes retinopathy which can result in blindness, kidney failure, and poor blood flow in the limbs which may lead to amputations; all of which can result with premature death.

Implications

Mir-122 can be used for diagnostics, prevention and as a therapeutic drug for T2DM in humans. Diagnosis may be applied by identifying individuals carrying the diabetes allele even pre-symptomatically, thus increasing the possibility of prevention through a healthy lifestyle or through medication. Therapeutics may be applied by administrating the pertinence with this innovative compound. Treating may include diagnostics, prevention, and therapy.

Prevalence

T2DM is a chronic metabolic disease. Each year it causes 1.5 million deaths and a further 2.2 million associated with elevated blood glucose. In 1980 there were 108 million cases reported around the world but this had risen to 422 million by 2014, mostly in middle and low income countries. A Harvard study published in April 2016 estimated that the cost of treating and managing the disease was $825 billion per year (https://www.hsph.harvard.edu/news/press-releases/diabetes-cost-825-billion-a- year/)