Born in Basra, Iraq, 1939. Immigrated to Israel in 1951.

Joined the faculty of agriculture, Hebrew University of Jerusalem in 1973 as a Lecturer in biometrical genetics and breeding; promoted to the positions of senior lecturer, associate professor and full professor in 1978, 1989 and 1992 respectively.

During the years 1978-9, 1985-6, 1992, 1993, 1999 and 2001 spent sabbatical leaves at: 
 
1) ABRO, Edinburgh, Scotland; 
2) Leicester, England; 
3) Guelph,Canada; 
4) VPI, Virginia; and 
5-6) Stanford University, USA.

Since 1985, his lab was focused in mapping projects and phylogenetic analyses. During these years, efforts were made to detect QTLs controlling complex traits, using several kinds of molecular markers in various species. In recent years, Deep Sequencing technologies were used for QTLs detection and biodiversity studies. The detected QTLs were used to produce customized microarrays as tools in breeding programs of chickens and turkeys.

 

Selected articles, out of more than 180 publications

• Z. Granevitze, L. David, T. Twito, S. Weigend, M.Feldman, and J. Hillel, 2013, Phylogenetic resolution power of microsatellites and various SNP types assessed in ten divergent chicken populations. Animal Genetics 2014: 87-95.
• Wells KL, Hadad Y, Ben-Avraham D, Hillel J, Cahaner A, Headon DJ, 2012, Genome-wide SNP scan of pooled DNA reveals nonsense mutation in FGF20 in the Scale-less line of featherless chickens. BMC Genomics. 2012 19;13(1):257. .
• Twito T., Madeleine D., Perl-Treves R., Hillel J. and Lavi U., 2011, Comparative genome analysis with the human genome revealed chicken genes associated with fatness and body-weight, Animal Genetics ;42(6):642-9.
• Twito T, Weigend S, Blum S, Granevitze Z, Feldman M.W, Perl-Treves R., Lavi U., Hillel J., 2007, Biodiversity of 20 Chicken Breeds Assessed by SNPs in coding regions, Cytogenetics and Genome Research 117: 319-326.
• Shen, P., Lavi, T., Kivisild, T., Chou, V., Sengun, D., Gefel, D., Shpirer, I., Woolf, E., Hillel, J., Feldman, M.,  and Peter J. Oefner, P.J., 2004, Reconstruction of patri- and matri-lineages of Samaritans and other Israeli populations from Y-chromosome and mitochondrial DNA sequence variation, Human Mutation24:248-60.
• Rosenberg, N.A., T. Burke, M.W. Feldman, P.J. Freidlin, A. M. Groenen, J. Hillel, A. Mäki-Tanila, M. Tixier-Boichard, A. Vignal, K. Wimmers, and S. Weigend, 2001. Empirical evaluation of genetic clustering methods using multilocus genotypes from 20 chicken breeds, Genetics 159: 699-713.
• Plotsky, Y., Cahaner, A., Haberfeld, A., Lavi, U., Lamont, S.J., and Hillel, J., 1993, DNA fingerprint bands applied to linkage analysis with quantitative trait loci in chickens, Animal Genetics24(2):105-110.
• Plotsky, Y., Cahaner, A., Haberfeld, A., Lavi, U., and Hillel, J., 1990, Analysis of genetic association between DNA fingerprint bands and quantitative traits by DNA mixes, in: Proceedings of the 4th World Congress on Genetics Applied to Livestock Production, Edinburgh, Scotland, pp. 133-136.
• Peter J. Oefner, Georg Hölzl, Peidong Shen, Isaac Shpirer, Dov Gefel, Tal Lavi, Eilon Wolf, Jonathan Cohen, Peter A. Underhill, Noah A. Rosenberg, Jochen Hochrein, Julie M. Granka, Jossi Hillel, Marcus W. Feldman, 2013,  Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim. Human Biology 2013: 825-857.
• Lior David, Shmuel Rothbardc, Israel Rubinsteinc, Hila Katzmanb, Gideon Hulatad, Jossi Hillel and Uri Lavi, 2004, Aspects of red and black color inheritance in the Japanese ornamental (Koi) carp (Cyprinus carpio L.), Aquaculture 233/1-4:129-147.
• Lahav T., G. Atzmon, S. Blum, G. Ben-Ari, S. Weigend, A. Cahaner, U. Lavi , J. Hillel, 2006, Marker assisted selection based on multi-trait economic index in chicken: experimental results and simulation, Animal Genetics 37: 482-488.
• Kopelman N.M, L.C. Wang, D. Gefel, M.W Feldman, J. Hillel, and N.A. Rosenberg, 2009, Genomic microsatellites identify shared Jewish ancestry intermediate between Middle Eastern and European populations, BMC Genetics, 10:80doi:10.1186/1471-2156-10-80.
• Jeffreys, A.J., Hillel, J., Hartley, N., Bulfield, G., Morton, D., Wilson, V., Wong, Z., and Harris, S., 1987, Hypervariable DNA and genetic fingerprint, Anim. Genet. 18:141-142.
• Hillel, J., Verrinder Gibbins, A.M., Etches, R.J., and McQ. Shaver, D., 1993, Strategies for the rapid introgression of a specific gene modification into a commercial flock from a single carrier, Poult. Sci. 72:1197-1211.
• Hillel, J., Schaap, T., Haberfeld, A., Jeffreys, A.J., Plotzky, Y., Cahaner, A., and Lavi, U., 1990, DNA fingerprints applied to gene introgression in breeding programs, Genetics 124:783-789.
• Hillel, J., Plotzky, Y., Gal, O., Haberfeld, A., Lavi, U., Dunnington, E.A., Siegel, P.B., Jeffreys, A.J., and Cahaner, A., 1989, DNA fingerprints in chickens, in: Proceedings of the 31st British Poultry Breeders' Roundtable Reading, England, pp. 1-11.
• Hillel, J., Plotsky, Y., Haberfeld, A., Lavi, U., Cahaner, A., and Jeffreys, A.J., 1989, DNA fingerprints of poultry, Animal Genetics 20:25-35.
• Hillel, J., Haberfeld, A., Gal, O., Plotsky, Y., and Cahaner, A., 1990, Association between DNA fingerprints and fatness in broilers, in: The XXVIII-th annual convention of the Israeli branch of the world's poultry science association, Zichron Yaacov, Israel.
• Hillel, J., Gefel, D., Kalman, R., Ben-Ari, G., David, L., Orion, O., Feldman, M. W., Bar-On, H., Blum, S., Raz, I., Schaap, T., Shpirer, I.,  Lavi, U., Shafrir, E.,  Ziv ,E., 2005, Evidence for a major gene affecting the transition from normoglycaemia to hyperglycaemia in Psammomys obesus, Heredity 95 (2): 158-165. See also the following editorial comment: P J Kaisaki and D Gauguier, 2005, Medical Genetics: Revenge of the thrift, Heredity 95, 337–338.
• Hillel, J., E.A. Dunnington, A. Haberfeld, U. Lavi, A. Cahaner, O. Gal, Y.P., H.L Marks, and Siegel, P.B., 1992, Multi locus DNA markers: applications in poultry breeding genetic analyses, in: Manipulation of the Avian Genome (A. Verrinder-Gibbins, R.J. Etches, ed.), CRC Press, Florida, pp. 243-256.
• Hillel, J., Dunnington, E.A., and Siegel, P.B., 1992, DNA markers in poultry breeding and genetic analysis, Poultry Science Reviews 4:169-186.
• Hillel, J., Avner, R., Baxter-Jones, C., Dunnington, E.A., Cahaner, A., and Siegel, P.B., 1990, DNA fingerprints from blood mixes in chickens and turkeys, Anim. Biotech. 1:201-204.
• Hillel, J., 1997, Map based Quantitative Trait Locus identification, Poult. Sci. 76:1115-1120.
• Hillel, J.,  Groenen, M.A.M., Tixier-Boichard, M., Korol, A.B., David, L., Kirzhner, V.M., Burke, T., Barre-Dirie, A., Crooijmans, R.P.M.A., Elo, K., Feldman, M.W., Freidlin, P.J., Mäki-Tanila, A., Oortwijn, M., Thomson, P., Vignal, A., Wimmers, K., Weigend, S., 2003, Biodiversity of 52 chicken populations assessed by microsatellite typing of DNA pools, Genetics Selection and Evolution 35:533-557.
• Hillel J., Z. Granevitze, T. Twito, D. Ben-Avraham, S. Blum, U. Lavi, L. David, M. W. Feldman, H. Cheng and S. Weigend, 2007, Molecular markers for the assessment of chicken biodiversity, World's Poultry Science Journal 63: 33-39.
• Granevitze Z., J. Hillel, S. G. H. Chen, N. T. K. Cuc and S. Weigend, 2007, Genetic diversity within chicken populations from different continents and management histories. Animal Genetics 38: 576–583.
• Granevitze Z., J. Hillel, M. Feldman, A. Six, H. Eding and S. Weigend, 2009, Genetic structure of a wide spectrum chicken gene pool, Animal Genetics, 686-93.
• Granevitze Z, Blum S, Cheng H, Vignal A, Morisson M, Ben-Ari G, David L, Feldman M.W., Weigend S, and Hillel J, 2007, Female-specific DNA sequences in the chicken genome, J. Heredity 98: 238-242.
• Dunnington, E.A., Stallard, L.C., Hillel, J., and Siegel, P.B., 1994, Genetic diversity among commercial chicken populations estimated from DNA fingerprints, Poult. Sci. 73:1218-1225.
• Dunnington, E.A., Gal, O., Siegel, P.B., Haberfeld, A., Cahaner, A., Lavi, U., Plotsky, Y., and Hillel, J., 1991, Deoxyribonucleic acid fingerprint comparisons between selected populations of chickens, Poultry Science 70:463-467.
• David, L., Blum, S., Feldman, M.W., Lavi, U., Hillel, J., 2003, recent duplication of the common carp (Cyprinus carpio L.) genome as revealed by analyses of microsatellite Loci, Mol Biol Evol 20: 1425-1434.
• David L, Rosenberg N.A., Lavi U, Feldman M.W., and Hillel J. (2007) Genetic diversity and population structure inferred from the partially duplicated genome of domesticated carp, Cyprinus carpio L., Genet. Sel. Evol. 39: 319–340.
• Cheng, H.H., Levin, I., Vallejo, R.L., Crittenden, L.B., Dodgson, J., Khatib, H., and Hillel, J., 1995, Genetic map of the chicken; development of a genetic map of the chicken with high utility markers, Poult. Sci. 74:1855-1874.
• Ben-Avraham D., S. Blum, Z. Granevitze, S. Weigend, H. Cheng and J. Hillel, 2006, W-specific microsatellite loci detected by in silico analysis map to chromosome Z of the chicken genome, Animal Genetics 37:180-181.
• Ben-Ari, G., David, L., Blum, S., Twito, T., Vignal, A., Weigend, S., Feldman, M. W., Lavi, U. and Hillel, J., 2005, Single Nucleotide Polymorphism (SNPs) in chicken: resources and possible applications, In:  Second Report on Chicken Genes and Chromosomes, Cytogenetic and Genome Research, 433-438.
• Ben-Ari G., Zenvirth D., Twito T., Blum S., Lavi T., David L., Sherman A., Fleischer H., Linial N., Friedman N., Hillel J., Simchen G., Lavi U., Discovery and genotyping of SNPs in yeast for gene hunting and the study of biodiversity, in: International Workshop on Application of Molecular Markers in Studies of Plants, Poland, Warsaw, September 25-29, 2002.
• Ben-Ari G., D. Zenvirth, A. Sherman, L. David, M. Klutstein, U. Lavi, J. Hillel and G. Simchen,  2006, Four linked genes participate in controlling sporulation efficiency in budding yeast, PLoS Biology: Vol 2, Issue 11.
• Ben-Ari G, D. Zenvirth, A. Sherman, G. Simchen, U. Lavi, and J. Hillel, 2005, Application of SNPs for assessing biodiversity and phylogeny among yeast strains, Heredity 95: 493-501.
• Atzmon, G., Cassuto, D., Lavi, U., Cahaner, A., Zeitlin, G.,  and  Hillel, J., 2002, DNA markers and crossbreeding scheme as means to select sires for heterosis in egg production of chickens, Animal Genetics 33:132-139.
• Atzmon G., Y. I. Ronin, A. Korol, N. Yonash, H. Cheng and J. Hillel, 2006, QTLs associated with growth traits and abdominal fat weight and their interactions with gender and hatch in commercial meat-type chickens, Animal Genetics 37: 352-358.
• Atzmon G., S. Blum, M. Feldman, U. Lavi, and J. Hillel, 2007, Detection of agriculturally important QTLs in chickens and analysis of the factors affecting genotyping strategy, Cytogenetics and Genome Research 117: 327-337.
• Atzmon G., S. Blum, M. Feldman, A. Cahaner, U. Lavi, and J. Hillel, 2008, QTLs detected in a multigenerational resource chicken population, J. Heredity, 99: 528-538.
• Rattner, D., and Hillel, J., 1990, The yaez, a goat x ibex cross, as a possible step in goat domestication, in: International Conference for Archaeozoology, Smithsonian Institution, Washington D.C.
• Voss, R., Ben-Simon, E., Avital, A., Godfrey, S., Zlotogora, J., Dagan, J., Tikochinski, Y., and J., H., 1989, Uniparental disomy of chromosome 7 and cystic fibrosis in man, Am. J. Hum. Genet. 45:373-380.
• Rattner, D., Hillel, J., the late Moav, R., Levin, I., and Avidan, N., 1985, The yaez, a cross of the wild ibex with the domestic goat as a new farm animal, World Review of Animal Production21:59-64.

 

In a project on biodiversity of chickens funded by the European Commission (EC), eight laboratories collaborated to assess the genetic variation within and between 52 populations from a wide range of chicken types.

Twenty-two di-nucleotide microsatellite markers were used to genotype DNA pools of 50 birds from each population. The polymorphism measures for the average, the least polymorphic population (inbred C line) and the most polymorphic population (Gallus gallus spadiceus) were, respectively, as follows: number of alleles per locus, per population: 3.5, 1.3 and 5.2; average gene diversity across markers: 0.47, 0.05 and 0.64; and proportion of polymorphic markers: 0.91, 0.25 and 1.0.

These were in good agreement with the breeding history of the populations. For instance, unselected populations were found to be more polymorphic than selected breeds such as layers. Thus DNA pools are effective in the preliminary assessment of genetic variation of populations and markers.

Mean genetic distance indicates the extent to which a given population shares its genetic diversity with that of the whole tested gene pool and is a useful criterion for conservation of diversity.

The distribution of population species (private) alleles and the amount of genetic variation shared among populations supports the hypothesis that the red jungle fowl is the main progenitor of domesticated chicken.

By Francesco Veronesi, Italy [CC BY-SA 2.0], via Wikimedia Commons

 

MIR 122 Is Possibly The Bassis To The Future Medicine For Diabetes Mellitus Type 2 (T2D)

We have discovered a compound (Mir122) which can be used as a medication to treat Type 2 diabetes mellitus (T2DM). The compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG, for silencing the complementary Messenger RNAs.

The Experimental Animal Population

We investigated the mode of inheritance of nutritionally induced diabetes in the desert gerbil Psammomys obesus (sand rat), following transfer from low-energy (LE) to high-energy (HE) diet which induces hyperglycaemia. Psammomys selected for high or low blood glucose level were used as two parental lines. A first backcross generation (BC1) was formed by crossing F1 males with females of the diabetes-prone line. The resulting 232 BC1progeny were assessed for blood glucose. All progeny were weaned at 3 weeks of age (week 0), and their weekly assessment of blood glucose levels proceeded until week 9 after weaning, with all progeny maintained on HE diet. At weeks 1 to 9 post weaning, a clear bimodal distribution statistically different from unimodal distribution of blood glucose was observed, normoglycaemic and hyperglycaemic at a 1:1 ratio. This ratio is expected at the first backcross generation for traits controlled by a single dominant gene. From week 0 (prior to the transfer to HE diet) till week 8, the hyperglycaemic individuals were significantly heavier (4–17%) than the normoglycaemic ones. The bimodal blood glucose distribution in BC1generation, with about equal frequencies in each mode, strongly suggests that a single major gene affects the transition from normo- to hyperglycaemia. The wide range of blood glucose values among the hyperglycaemic individuals (180 to 500 mg/dl) indicates that several genes and environmental factors influence the extent of hyperglycaemia. The diabetes-resistant allele appears to be dominant; the estimate for dominance ratio is 0.97.

Tino Strauss [CC BY-SA 2.5], via Wikimedia Commons

Type 2 Diabetes Melitus

T2DM is a long term metabolic disorder that is characterized by high blood sugar, insulin resistance, and relative lack or low insulin production. Common symptoms include increased thirst, frequent urination, and unexplained weight loss. Long-term complications from high blood sugar include heart disease, strokes, diabetes retinopathy which can result in blindness, kidney failure, and poor blood flow in the limbs which may lead to amputations; all of which can result with premature death.

Implications

Mir-122 can be used for diagnostics, prevention and as a therapeutic drug for T2DM in humans. Diagnosis may be applied by identifying individuals carrying the diabetes allele even pre-symptomatically, thus increasing the possibility of prevention through a healthy lifestyle or through medication. Therapeutics may be applied by administrating the pertinence with this innovative compound. Treating may include diagnostics, prevention, and therapy.

Prevalence

T2DM is a chronic metabolic disease. Each year it causes 1.5 million deaths and a further 2.2 million associated with elevated blood glucose. In 1980 there were 108 million cases reported around the world but this had risen to 422 million by 2014, mostly in middle and low income countries. A Harvard study published in April 2016 estimated that the cost of treating and managing the disease was $825 billion per year (https://www.hsph.harvard.edu/news/press-releases/diabetes-cost-825-billion-a- year/)

 

 

Genetic Identity Of Ethnic Groups In Israeli

Biodiversity and phylogenetic analysis

Biodiversity and phylogeny of worldwide chicken populations. Phylogeny based on Y chromosome-specific microsatellites in man (males) and W-specific in chicken (females). Matrilineal analysis based on mitochondria and W chromosome in chicken. Reconstruction of the Samaritans history.

 

Genetic History Of The Samaritans

Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim

Human Biology, Volume 85, Number 6, December 2013, pp. 825-857 (Article)

The Samaritans are a group of some 750 indigenous Middle Eastern people, about half of whom live in Holon, a suburb of Tel Aviv, and the other half near Nablus. The Samaritan population numbered is believed to have more than a million in late Roman times, but less than 150 in 1917. The ancestry of the Samaritans has been subject to controversy from late Biblical times to the present. In this study, liquid chromatography-electrospray ionization quadrupole ion trap mass spectrometry was used to allelotype 13 Y-chromosomal and 15 autosomal microsatellites in a sample of 12 Samaritans chosen to have as low a level of relationship as possible, and 461 Jews and non-Jews. Estimation of genetic distances between the Samaritans and seven Jewish and three non-Jewish populations from Israel, as well as populations from Africa, Pakistan, Turkey, and Europe, revealed that the Samaritans were closely related to Cohanim. This result supports the position of the Samaritans that they are descendants from the tribes of Israel dating to before the Assyrian exile in 722–720 BCE. In concordance with previously published single-nucleotide polymorphism haplotypes, each Samaritan family, with the exception of the Samaritan Cohen lineage, was observed to carry a distinctive Y-chromosome short tandem repeat haplotype that was not more than one mutation removed from the six-marker Cohen modal haplotype.

Samaritans marking Passover on Mount Gerizim, Edward Kaprov [CC BY-SA 3.0 or GFDL], via Wikimedia Commons

 

הגיגים על ישראל ופלסטין

במהלך מאות השנים  חיו ערבים בארץ ישראל שהיגרו אליה מאז המאה השבע עשרה מארצות ערב שונות אבל בעיקר מערב הסעודית ומסוריה. אוכלוסיות אלה חיו במסגרות משפחתיות רחבות (חמולות) במסגרות כפריות או כמשפחות מצומצמות. מהגרים אלה התיישבו גם  בערים כגון רמאללה, שכם, ג'נין, יריחו, עזה, רפיח, יפו, חיפה, עכו וישובים קטנים באזור ירושלים. אוכלוסיות אלה ממספר דתות, אך בעיקר מוסלמיות, התעבו והתרחבו. הפלסטינים היו אוכלוסיות אך מעולם לא היו עם. עם הוא אוכלוסייה שעברה היסטוריה משותפת למשך דורות רבים. לא ניתן בצורה שרירותית להחליט על קיומו של עם; לא כל אוכלוסייה היא עם.

מאידך, היהודים עברו היסטוריה מגוונת במהלך 3500 השנים האחרונות (כ 150 דורות) עם הרבה מלחמות, חורבנות, הגליות והגירות לארצות רבות ברחבי העולם. אוכלוסיות אלה שמרו על זהותם היהודית גם תחת גזרות שמד אכזריים ומהלכים בל יאומנו של רצח עם. מכאן, היהודים הם אכן עם למרות שרובו לא חי בארץ ישראל. יודגש כי בהגדרות אלה לא צוינה שום זכות יתר לאחד משני הצדדים.

איך ניתן לחלוק את השטח שבין הים התיכון לנהר הירדן , לאוכלוסייה הפלסטינית ולעם היהודי

• שתי מדינות: בתוכנית זאת יוקמו שתי מדינות; מדינת פלסטין ומדינת ישראל. ההבדל היחיד ביניהן יהיה שרק למדינת ישראל תהיה הזכות להחזיק צבא. לכל אחת משתי המדינות יהיו משרדי שלטון כנדרש, כולל בטחון פנים, חוץ, אוצר, חינוך, מורשת,..... כך, לכל תושב תהיה תעודת זהות ודרכון של המדינה אליה שייך. לכל אחת משתי המדינות יהיו נציגויות בינלאומיות בכל מדינות העולם כולל האו"ם
• קנטוניזציה וירטואלית אתנית – לא גאוגרפית: התושבים שבין הים לירדן יחולקו לקנטונים שעיקרם אתניים (לשם ההמחשה, נאמר 100 קנטונים). כל אחד מתושבים אלה יהיה שייך לאחד ממאה הקנטונים. כך לדוגמה, ייתכן ששני תושבים שכנים שגרים באותו רחוב בחברון ישויכו לפי בחירתם לשני קנטונים שונים. השיוך לקנטונים יהיה חד פעמי עם גמישות מתאמת, אחת לעשר שנים.
• פרלמנטים: יוקמו שני פרלמנטים; פלסטיני וישראלי
• בחירות לממשל הקנטוני: אוכלוסייה של כל קנטון תבחר את נציגיה לפרלמנט שלה
• שיוך קנטון למדינה: ייערכו בחירות כלליות בהם יבחרו תושבי כל קנטון לאיזו אחת משתי המדינות ירצה הקנטון להיות שייך. אם לדוגמה, כל או רוב הקנטונים יבחרו להשתייך למדינת ישראל, תיווצר "מדינה אחת לשני העמים", בבחירה. אם לעומת זאת ההתפלגות לשתי המדינות תהיה בעיקרה אתנית, תיווצרנה "שתי מדינות לשני העמים", בבחירה
• ממשלים: כל אחד משני הפרלמנטים ירכיב את ממשלתו ללא קשר או תלות בפרלמנט של האחר
• משפט: לכל מדינה תהיה מערכת משפט עצמאית
• חוקה: לכל אחת משתי המדינות תהיה חוקה משלה ללא תלות בחוקה של האחר
• שלטון מוניציפלי: לכל קנטון יהיה שלטון מוניציפאלי עצמאי בפיקוח משרדי הפנים של המדינה אליה שייך
• הגירה: לכל אחת משתי המדינות תהיה מדיניות של הגירת פנים משלה. כל מהגר, ללא קשר לעברו ההיסטורי או לעבר משפחתו שירצה להגר לאחת משתי המדינות, ישויך לאחד הקנטונים במדינה לפי החלטת המדינה על פי שיוכו האתני ובחירתו האישית; ערבי לאחד הקנטונים במדינת פלסטין ויהודי לאחד הקנטונים במדינת ישראל.
• סיום הכיבוש ופינוי התנחלויות: לא יהיה צורך בסיום הכיבוש ופינוי התנחלויות כי הפתרון הוא אינהרנטי
• שיבה: לא יהיה צורך בפתרון פרטני כי בתוכנית המוצעת הפתרון הוא אוכלוסייתי.